A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0083Publication date: 1991
PMID: 1850232GI: 9626649 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): N/A bp
MgCl2: N/A mMdNTPs: mMType: Hybridization
Temp (PCR cycle):50C 2hr
Buffer: 6x NET, 0.1% SDS, 5x Denhardt's, and 1.5-2.0x 10^7 cpm of end labelled oligonucleotide
Polymerase: N/ACycler: N/A
Note: Prehybridization: dot blots were prehyberdized at 65C for 4-5hr in 6x NET, 0.1% SDS, 5x Denhardt's, and 100microg/ml of denatured salmon sperm DNA.
Washing: After hybridization dot blots were washed as follows, 3 times in 6x SSC/0.1% SDS at room tempeture each for 5min, 2 times in 3x SSC/0.1% SDS at 50C each fo 30 min, and 2 times in 1x SSC/0.1% SDS at 50C each for 20min.
GI#:(PMID: 2844971)Collett MS, Anderson DK, Retzel E (1988) Comparisons of the Pestivirus bovine viral diarrhea virus with members of the Flaviviridae. J Gen Virol 69: 2637-2643
Reverse(ND001) primer
Oligo type: HybridizationDegeneracy: 1
Target: 386-367Tm: 72 C at salt 1000.0mMLength:
Sequence: TGTGCCATGTACAGCAGAGA
(0 other experimental conditions)
Note:
Reverse(ND002) primer
Oligo type: HybridizationDegeneracy: 1
Target: 3308-3289Tm: 70 C at salt 1000.0mMLength:
Sequence: TTTCATATGGTCTGCAAGGC
(0 other experimental conditions)
Note:
Reverse(ND003) primer
Oligo type: HybridizationDegeneracy: 1
Target: 6073-6054Tm: 67.9 C at salt 1000.0mMLength:
Sequence: GTTCATGCTGGTTATCTTCT
(0 other experimental conditions)
Note:
Reverse(ND004) primer
Oligo type: HybridizationDegeneracy: 1
Target: 7015-6996Tm: 70 C at salt 1000.0mMLength:
Sequence: GTCATAGTGGTAGTCCTTTG
(0 other experimental conditions)
Note:
Reverse(ND005) primer
Oligo type: HybridizationDegeneracy: 1
Target: 7919-7900Tm: 72 C at salt 1000.0mMLength:
Sequence: CTGTTTCATGCCCCAGTCTT
(0 other experimental conditions)
Note:
Reverse(ND006) primer
Oligo type: HybridizationDegeneracy: 1
Target: 11380-11361Tm: 67.9 C at salt 1000.0mMLength:
Sequence: TACTTCACCATCTGCTGTTA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.