A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0081Publication date: 01/94
PMID: 8011781GI: 7960753 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): 205 bp
MgCl2: 1.4 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 1min>55C 1min>72C 2min)*40
Buffer: 40mM Tris-HCl, 60mM KCl, 1% gelatin, 5microL RT reaction
Polymerase: 0.5U/microL Taq poly (Promega, Madison, WI.)Cycler: N/A
Note: RT procedure - materials 40microM of each primer (MP00811 and MP00812), 7.5microM dNTP's, 4microL Schimke solution (10mM dithiothreitol, 10mM MgCl2, 70mM KCl, 80mM Tris; pH 8), 0.196U/microL reverse transcriptase (Life Sciences, St. Petersburg, FL.), 28U/microL RNase inhibitor (Promega, Madison, WI.). RT mixture was incubated at 42C 2hr.
Forward(MP00811) primer
Oligo type: PCRDegeneracy: 1
Target: 9893-9912Tm: 65.8 C at salt 1000.0mMLength:
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note:
Reverse(MP00812) primer
Oligo type: PCRDegeneracy: 1
Target: 10098-10079Tm: 65.8 C at salt 1000.0mMLength:
Sequence: ACATCTCCTACTAAGTAGTA
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.