A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0079Publication date: 04/94
PMID: 7985409GI: N/A Taxonomy ID: 11101
Virus Name: pestivirus type 3, BDVProduct size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 2min>(94C 1min>55C 1min>72C 3min)*30>72C 30min
Buffer: 1x PCR Buffer (100mM KCl, 10mM Tris-HCl pH 8.3), 0.25mM dithiothreitol
Polymerase: 2.5U/microL Amplitaq poly (Perkin-Elmer Cetus Corp., Norwalk, CT)Cycler: N/A
Note: RT-procedure - materials: PCR materials, 2.7U RAV reverse transcriptase (Amersham Corp., Arlinton Heights, IL), 40U RNasin (Promega Corp., Madison WI.), RT reaction carried out at 55C 60min. PCR was then performed without adding anything. Separate PCRs were performed with a pair of PCR primers. Search for start and stop ends of primers did not bring up any results.
Forward(p1) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 74.7 C at salt 1000.0mMLength:
Sequence: ACGAGAATTAGAAAAGACACTCGTATAC
(0 other experimental conditions)
Note: Used with p2
Reverse(p2) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 74.7 C at salt 1000.0mMLength:
Sequence: AAGTTCATTTGAAAACAACTCCATGTGC
(0 other experimental conditions)
Note: Used with p1
Forward(p3) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 85.2 C at salt 1000.0mMLength:
Sequence: CCTGATAGGGTGCTGCAGAGGCCCAC
(0 other experimental conditions)
Note: Used with p4
Reverse(p4) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 74.7 C at salt 1000.0mMLength:
Sequence: CACCAACCATGCTTGTTCCACT
(0 other experimental conditions)
Note: Used with p3
Forward(p5) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 80.5 C at salt 1000.0mMLength:
Sequence: AAGACCAACACACGTGTTGCAGGTTGC
(0 other experimental conditions)
Note: Used with p6
Reverse(p6) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 80.6 C at salt 1000.0mMLength:
Sequence: TCACACACTGTGCATACATTGCAGTGCTTG
(0 other experimental conditions)
Note: Used with p5
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.