A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0077Publication date: 04/90
PMID: 2164736GI: 7960753 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): N/A bp
MgCl2: 6 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):see additional note
Buffer: N/A
Polymerase: 2U Taq DNA poly (Perkin-Elmer Cetus)Cycler: N/A
Note: RT procedure: RT was performed in a total volume of 100microL using 200microg/mL total RNA, 1mM dNTPs, 100microg/mL of pDN6 random primer (Pharmacia), and 8U/microL of M-MLV RTase (Bethesda Research Laboratories) in recomended conditions.

PCR procedure: PCR was performed as recommended by Perkin-Elmer Cetus but with 6mM MgCl2 using 10microL cDNA and 1microg of each primer.
PCR cycle - 30 cycles of denaturation, annealing (at 52C), and elongation.
Final PCR volume is not mentioned in the article.
Forward(A) primer
Oligo type: PCRDegeneracy: 1
Target: 4617-4646Tm: 79.3 C at salt 1000.0mMLength:
Sequence: GGAATTCAGCACTCATAGAGCTAAACTGGT
(0 other experimental conditions)
Note:
Reverse(B) primer
Oligo type: PCRDegeneracy: 1
Target: 5584-5558Tm: 82.1 C at salt 1000.0mMLength:
Sequence: GGGATCCAGTCCCCTCCTCACTTTTAG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.