A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0076Publication date: 01/93
PMID: 8384762GI: 323205 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): N/A bp
MgCl2: 2 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 1min>53C 1min>72C 2min)*35
Buffer: 1x PCR Buffer (50mM KCl, 10mM Tris-HCl pH 8.3), 2mM DTT
Polymerase: 0.025U/microL Amplitaq poly (Perkin-Elmer Cetus Corp.)Cycler: N/A
Note: RT-procedure - Used 1xPCR buffer and MgCl2 listed above, 15ng/microL random hexamers, 1U/microL of RNasin (Promega), 10mMDTT, 1mM dNTPs, 10U/microL M-MLV reverse transcriptase (BRL). RT reaction was performed at 37C 30sec>42C 5min>99C 5min.
Forward(B) primer
Oligo type: PCRDegeneracy: 1
Target: 7436-7455Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GTGGAGACTGGGAAAGCACT
(0 other experimental conditions)
Note:
Reverse(C) primer
Oligo type: PCRDegeneracy: 1
Target: 5609-5591Tm: 54 CLength:
Sequence: TTGGTGTGTGTAAGCCCA
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.