A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0075Publication date: 12/89
PMID: 2162162GI: 323205 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR):
bp
MgCl2: 10 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 3min>62C 5min>(95C 30sec>62C 45sec)*34>62C 10min
Buffer: 50mM Tris-HCl (pH 8.3), 50mM KCl, 1mM dithiothreitol, 1mM EDTA
Polymerase: 0.08U/microL Taq poly (Amersham corp.)Cycler:
Note: Primer sets PBVD7/PBVD8 (600bp) and PBVD9/PBVD10 (300bp) are used in separate PCRs.

Total RT volume is 40microL containing 50mM Tris-HCl (pH 8.3), 50mM KCl, 10mM MgCl2, 1mM dithiothreitol, 1mM EDTA, 10mM primers, and 0.125U/microL AMV RTase (Promega).
RT temperature: 50C 1hr

Total PCR volume is 50microL containing 5-10microL cDNA and 1microM primers.
Article cites dNTP concentration as 200mM.
Forward(PBVD4) primer
Oligo type: PCRDegeneracy: 1
Target: 386-410Tm: 73.2 C at salt 1000.0mMLength:
Sequence: GAATTCAGCCTATTATGGACCCA
(1 other experimental conditions)
Note: Used with PBVD3
Reverse(PBVD3) primer
Oligo type: PCRDegeneracy: 1
Target: 861-838Tm: 73.2 C at salt 1000.0mMLength:
Sequence: GAATTCAGCCTATTATGGACCCA
(1 other experimental conditions)
Note: USED WITH PBVD4
Forward(PBVD7) primer
Oligo type: PCRDegeneracy: 1
Target: 5001-5020Tm: 76.1 C at salt 1000.0mMLength:
Sequence: GCCGATGCCAGGGAAAGCAT
(0 other experimental conditions)
Note: Used with PBVD8.
Reverse(PBVD8) primer
Oligo type: PCRDegeneracy: 1
Target: 5600-5581Tm: 76.1 C at salt 1000.0mMLength:
Sequence: GTGTGTAAGCCCAGCCAGTC
(0 other experimental conditions)
Note: Used with PBVD7.
Forward(PBVD9) primer
Oligo type:
Degeneracy: 1
Target: 9001-9020Tm: 67.9 C at salt 1000.0mMLength:
Sequence: GTATTACGATGACAACCTCA
(0 other experimental conditions)
Note: Used with PBVD10.
Reverse(PBVD10) primer
Oligo type: PCRDegeneracy: 1
Target: 9300-9281Tm: 70 C at salt 1000.0mMLength:
Sequence: GCACACCCCTTCTTCATTTT
(0 other experimental conditions)
Note: Used with PBVD9.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.