A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0074Publication date: 03/94
PMID: 8068309GI: 7960753 Taxonomy ID: 144353
Virus Name: bovine viral diarrhea virus, BVDVProduct size (PCR): 205 bp
MgCl2: 1 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 1min>55C 1min> 75C 2min)*40
Buffer: PCR buffer (Promega)
Polymerase: 0.25U/microL Taq poly (Promega)Cycler: N/A
Note: RT procedure - RNA was added to a reverse transcription reaction containing 1U/microL avian myeloblastosis virus reverse transcriptase (Promega, Madison, WI, U.S.A.), 4U/microL rRNasin (Promega), 0.2mM dNTP's in reverse transcriptase buffer (Promega). RT was performed for 2 hours at 42C.
Forward(Primer 2.1) primer
Oligo type: PCRDegeneracy: 1
Target: 9893-9912Tm: 65.8 C at salt 1000.0mMLength:
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note:
Reverse(Primer 2.2) primer
Oligo type: PCRDegeneracy: 1
Target: 10098-10079Tm: 65.8 C at salt 1000.0mMLength:
Sequence: ACATCTCCTACTAAGTAGTA
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.