A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0070Publication date: 10/94
PMID: 7524039GI: 323205 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR):
bp
MgCl2: 1.7 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 30sec>56C 1min>74C 1min)*30
Buffer: 10mM Tris-HCl pH 9.0, 50mM KCl, 0.1% (w/v) gelatine, 1% (v/v) Triton X-100
Polymerase: 0.01U/microL Taq poly (Stehelin, Basel, CH)Cycler: N/A
Note: RT procedure - cDNA was synthesized by incubating 1 microg of total RNA from vius-infected cells with 0.8 microM of primer MP00702 in a 50 microL reaction volume containing 50mM Tris-HCl pH 8.3, 1mM MgCl2, 75mM KCl, 10mM DTT, 0.8U/microL Rnasin (Promega, Madison, WI, USA), and 0.5mM deoxynucleotide triphosphates. Either 0.16U/microL AMV reverse transcriptase (Promega, Madison, WI, USA) or 4U/microL Superscript (RNase H-) Mu-MLV reverse transcriptase (BRL, Gaitersburg, MD, USA) were added and the mixes incubated for 1.5hr at 42C or 37C respectively. ; 10microL RT reaction was used in PCR
Forward(MP00701) primer
Oligo type: PCRDegeneracy: 1
Target: 6810-6829Tm: 72 C at salt 1000.0mMLength:
Sequence: TGGACACGGTTATAGACACG
(0 other experimental conditions)
Note:
Reverse(MP00702) primer
Oligo type: PCRDegeneracy: 1
Target: 7367-7348Tm: 70 C at salt 1000.0mMLength:
Sequence: CAGTAGCGTAGATATACACG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.