A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0044Publication date: 03/00
PMID: 10730955GI: 14113964 Taxonomy ID: 144353
Virus Name: bovine viral diarrhea virus, BVDVProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 4min>(95C 1min>56C 1.5min>74C 1min)*40
Buffer: 1x PCR buffer (Promega), 0.03U/microL Taq Extender (Stratagene)
Polymerase: 0.03U/microL Taq poly (Promega)Cycler: N/A
Note: This experiment used 4 different primers in 3 combinations,
Primers UTR1 and UTR2 are from Radwan et al., 1995 [PMID:7667908]
The other two primers, 324 and 326, are from Vilcek S, et. al., 1994 [PMID:8031236]
RT procedure: 40microL reaction containing 1x M-MLV buffer (US Biochemical, Cleveland, OH), 0.5mM dNTPs, 5microM hexanucleotide primers (Gibco BRL), 0.001U/microL RNase inhibitor, and 5U/microL M-MLV RTase.
RT tempeture: 37C overnight.

PCR was performed in a total volume of 50microL with 0.1microM of each primer and 5microL of cDNA reaction.
Primer combinations:
UTR1 and UTR2, 324 and 326, UTR1 and 326
Forward(UTR1) primer
Oligo type: PCRDegeneracy: 1
Target: 51-68Tm: 58 CLength:
Sequence: GGCTAGCCATGCCCTTAG
(4 other experimental conditions)
Note: Used with 326, most effective at detecting virus
Reverse(UTR2) primer
Oligo type: PCRDegeneracy: 1
Target: 297-280Tm: 58 CLength:
Sequence: GCCTCTGCAGCACCCTAT
(1 other experimental conditions)
Note: In one PCR used with UTR1, most effective at detecting Virus. In second PCR used with 326 detected virus only 37% of time.
Forward(324) primer
Oligo type: PCRDegeneracy: 2
Target: 59-79Tm: 73.9 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)TAGTAGGACTAGCA
(6 other experimental conditions)
Note: Used with 326 detected virus only 10.5%
Reverse(326) primer
Oligo type: PCRDegeneracy: 1
Target: 347-327Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Used with 324 in one PCR detected virus only 10.5%, in second PCR used with UTR1 detected virus only 37%
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.