A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0042Publication date: 09/94
PMID: 7802385GI: 221806 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV 1Product size (PCR): 183 bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*34>95C 1min>61C 1min>72C 5min
Buffer: 1.25x Taq polymerase buffer (62.5 mM KCl, 12.5mM Tris-HCl pH 9.0, 1% Triton X-100), 10% glycerol
Polymerase: 0.042U/microL Taq polyCycler: DNA thermal cycler (Perkin-Elmer Canada Ltd, Dartmouth, Nova Scotia, Canada.)
Note: Hot start PCR performed as in:(PMID:7763918)Haff L. PCR: applications and alternative technologies. Bio/Technology 1993;11:938-939
Forward(IBR TK1) primer
Oligo type: PCRDegeneracy: 1
Target: 973-994Tm: 74.7 C at salt 1000.0mMLength:
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:
Reverse(IBR TK2) primer
Oligo type: PCRDegeneracy: 1
Target: 1155-1136Tm: 76.1 C at salt 1000.0mMLength:
Sequence: ACACGTCCAGCACGAACACC
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.