A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0032Publication date: 05/95
PMID: 7636978GI: 330764 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 3min>(95C 1min>65C 1min>72C 3min[+2sec/cyc])*40>72C 7min
Buffer: 10% gycerol
Polymerase: 0.02U/microL Taq polyCycler:
Note: 2-5microg total RNA is reverse transcribed with 1microg dT(12-18).
Article does not mention other RT conditions.

Article does not mention PCR buffer and dNTP concentration.
Each primer pair is used in a separate PCR:
MP00320/MP00321 uses 1.0mM MgCl2.
MP00322/MP00323 uses 1.0mM MgCl2.
MP00324/MP00325 uses 1.5mM MgCl2.

For other PCRs from this article, [see MP0030] and [see MP0031].
Forward(MP00320) primer
Oligo type: PCRDegeneracy: 1
Target: 1672-1692Tm: 82.2 C at salt 1000.0mMLength:
Sequence: CGCTCCCCTTCGTCCCTCCTCA
(0 other experimental conditions)
Note: Used with MP00321.
Sequence given in article has an extra "T" between positions 1680 and 1681.
Reverse(MP00321) primer
Oligo type: PCRDegeneracy: 1
Target: 1834-1815Tm: 80.2 C at salt 1000.0mMLength:
Sequence: GACGAGACCCCCGATTGCCG
(1 other experimental conditions)
Note: Used with MP00320.
Forward(MP00322) primer
Oligo type: PCRDegeneracy: 1
Target: 1755-1774Tm: 80.2 C at salt 1000.0mMLength:
Sequence: TTCTCTGGGCTCGGGGCTGC
(1 other experimental conditions)
Note: Used with MP00323.
Reverse(MP00323) primer
Oligo type: PCRDegeneracy: 1
Target: 1946-1924Tm: 80.4 C at salt 1000.0mMLength:
Sequence: AGAGGTCGACAAACACCCGCGGT
(1 other experimental conditions)
Note: Used with MP00322.
Forward(MP00324) primer
Oligo type: PCRDegeneracy: 1
Target: 1856-1873Tm: 62 CLength:
Sequence: TGGGGGGCGCGGAAACTG
(0 other experimental conditions)
Note: Used with MP00325.
Reverse(MP00325) primer
Oligo type: PCRDegeneracy: 1
Target: 2020-2003Tm: 64 CLength:
Sequence: AGTCGAGGCGCACGCGGG
(0 other experimental conditions)
Note: Used with MP00324.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.