A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0030Publication date: 05/95
PMID: 7636978GI: 330764 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 3min>(95C 1min>65C 1min>72C 3min[+2sec/cyc])*40>72C 7min
Buffer: 10% gycerol, 1x commercial PCR buffer
Polymerase: 0.02U/microL Taq polyCycler:
Note: 1250ng/microL RNA and 0.75microM primer 1815 or 2.5microM dT(12-18) (Invitrogin) in 4microL Tris-EDTA is incubated at 65C 5min then chilled on ice.
Total RT volume is 20microL containing 4microL RNA-primer mix, 16mM Tris-HCl (pH 8.3), 40mM KCl, 2mM MgCl2, 80ng/microL BSA, 0.8mM DTT, 0.4mM each dNTP, 0.5U/microL RNasin (Promega), and 5U/microL RNase H- RTase (Stratagene).
RT temperature: 20C 10min>45C 60min>95C 5min

Total PCR volume is 50microL containing 2.5microL cDNA and 1microM each primers 1629 and 872.

Probe 1 and probe 2 are used to hybridize with PCR products in separate reactions. Article does not mention hybridization protocol.

For other PCRs from this article, [see MP0031] and [see MP0032].
Reverse(1815) primer
Oligo type: OtherDegeneracy: 1
Target: 1834-1815Tm: 80.2 C at salt 1000.0mMLength:
Sequence: GACGAGACCCCCGATTGCCG
(1 other experimental conditions)
Note: Used in RT.
Reverse(1629) primer
Oligo type: PCRDegeneracy: 1
Target: 1629-1604Tm: 85.2 C at salt 1000.0mMLength:
Sequence: GGCCCGCCGGAGAAGAAGGACAGAGT
(0 other experimental conditions)
Note:
Forward(872) primer
Oligo type: PCRDegeneracy: 1
Target: 873-897Tm: 83.7 C at salt 1000.0mMLength:
Sequence: AGGCTGGGGGTCGCAAATACACGGC
(0 other experimental conditions)
Note:
Forward(probe 1) primer
Oligo type: HybridizationDegeneracy: 1
Target: 898-920Tm: 87.5 C at salt 1000.0mMLength:
Sequence: GGTGCGGTGTGGTGGCCTGCGGG
(0 other experimental conditions)
Note:
Reverse(probe 2) primer
Oligo type: HybridizationDegeneracy: 1
Target: 1606-1585Tm: 84 C at salt 1000.0mMLength:
Sequence: AGTTAGACCGCGCCCGGACCCC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.