A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0027Publication date: 07/96
PMID: 9035371GI: 537306 Taxonomy ID: 10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper), BHV-1.1, Bovine herpesvirus 1.2, BHV-1.2Product size (PCR): 550 bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 2min>(95C 1min>60C 1min>72C 2min[+5sec/cyc])*35
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.04U/microL Taq polyCycler: model 480 DNA thermalcycler (Perkin Elmer Cetus)
Note: Primer sets are used in separate PCRs:
Primer set IBR1/IBR2 amplifies BHV-1.1 [Taxonomy:10323].
Primer set IBR2/IBR3 amplifies BHV 1.2 [Taxonomy:10320]

Total PCR volume is 50microL containing 0.04-0.08ng/microL DNA and 1microM each primer in a set.
Taq polymerase is added in a "hot start" as described by Chou et al, (1992) [PMID:1579465].
Forward(IBR1) primer
Oligo type: PCRDegeneracy: 1
Target: 1-24Tm: 80.4 C at salt 1000.0mMLength:
Sequence: AGCAGGCCCGCGAGATGATCAAGT
(0 other experimental conditions)
Note: Used with IBR2 to amplify BHV-1.1.
Derived from [GI:537306].
Reverse(IBR2) primer
Oligo type: PCRDegeneracy: 1
Target: 577-552Tm: 74.2 C at salt 1000.0mMLength:
Sequence: TTGCATTACTTTTGGGGTCAAATGTG
(1 other experimental conditions)
Note: Used with IBR1 to amplify BHV-1.1 and IBR3 to amplify BHV-1.2.
Forward(IBR3) primer
Oligo type: PCRDegeneracy: 1
Target: 237-263Tm: 76 C at salt 1000.0mMLength:
Sequence: ATTTAAGTGCACACCGTGTTATTTGCG
(0 other experimental conditions)
Note: Used with IBR2 to amplify BHV-1.2. Derived from [GI:537304].
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.