A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0023Publication date: 04/95
PMID: 7648521GI: 221806 Taxonomy ID: 10322
Virus Name: Bovine herpesvirus 1 (strain 6660), BHV-1Product size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*35>72C 4min
Buffer: 1x Taq polymerase buffer, 10% glycerol
Polymerase: 0.025U/microL Taq poly (Bio-Can Scientific, Mississauga, Ontario)Cycler: DNA Thermocycler 480 (Perkin-Elmer)
Note: Total PCR volume is 100microL containing 1microL sample, 0.4microM each primer, and 1 Ampliwax gem (Perkin Elmer Cetus).
Forward(TK1) primer
Oligo type: PCRDegeneracy: 1
Target: 975-995Tm: 72.5 C at salt 1000.0mMLength:
Sequence: ACCCCAGTTGTGATGAATGCA
(0 other experimental conditions)
Note:
Reverse(TK2) primer
Oligo type: PCRDegeneracy: 1
Target: 1156-1137Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GTATTCGTGCTGGACGTGTC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.