A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0021Publication date: 07/91
PMID: 1911989GI: 331084 Taxonomy ID: 35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1Product size (PCR): 487 bp
MgCl2: N/A mMdNTPs: mMType: Nested PCR 1
Temp (PCR cycle):94C 7min>(94C 60sec>62C 30sec>72C 75sec)*35>72C 7min
Buffer: recomended concentration of comercial reagant (Perkin-Elmer Cetus, Emeryville, CA)
Polymerase:
Cycler:
Note:
Forward(MP00211) primer
Oligo type: PCRDegeneracy: 1
Target: 14-38Tm: 80.5 C at salt 1000.0mMLength:
Sequence: TCGTCAGTAAACAGCCTGCTGGTGC
(0 other experimental conditions)
Note:
Reverse(MP00212) primer
Oligo type: PCRDegeneracy: 1
Target: 494-471Tm: 74.4 C at salt 1000.0mMLength:
Sequence: GGGAAGAGACTTGTCTGTACC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.