A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0019Publication date: 04/93
PMID: 8227276GI: 330745 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR): 325 bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR 2
Nested PCR 1
Temp (PCR cycle):92C 4min>(94C 1min>60C 1min>72C 1min)*10>(94C 1min>65C 1min>72C 1min)*30>72C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl, 8% DMSO
Polymerase: 0.06U/microL Taq poly (Gibco BRL)Cycler: Hybaid thermal reactor (National Labnet Co.; Woodbridge, NJ)
Note: For primary PCR, [see MP0018].

MP00191 is used for probe in Southern blot hybridization.
Forward(BHV1-4bF-INT) primer
Oligo type: PCRDegeneracy: 1
Target: 394-421Tm: 80.6 C at salt 1000.0mMLength:
Sequence: ACGGTCATATGGTACAAGATCGAGAGCG
(0 other experimental conditions)
Note:
Reverse(BHV1-4bR-INT) primer
Oligo type: PCRDegeneracy: 1
Target: 716-696Tm: 80.3 C at salt 1000.0mMLength:
Sequence: CCAAAGGTGTACCCGCGAGCC
(0 other experimental conditions)
Note:
Forward(MP00191) primer
Oligo type: HybridizationDegeneracy: 1
Target: 518-541Tm: 85.5 C at salt 1000.0mMLength:
Sequence: GCTTCCTGGCGGGCTTCGCCTACC
(0 other experimental conditions)
Note: labled with digoxigenin
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.