A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0018Publication date: 04/93
PMID: 8227276GI: 330745 Taxonomy ID: 10320
Virus Name: Bovine Herpesvirus 1, BHV-1Product size (PCR): 468 bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR 1
Temp (PCR cycle):92C 4min>(94C 1min>60C 1min>72C 1min)*10>(94C 1min>65C 1min>72C 1min)*30>72C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl, 8%DMSO
Polymerase: 0.06U/microL Taq poly (Gibco BRL)Cycler: Hybaid thermal reactor (National Labnet Co., Woodbridge, NJ)
Note: For secondary PCR, [see MP0019].
Forward(BHV1-4F-EXT) primer
Oligo type: PCRDegeneracy: 1
Target: 351-368Tm: 60 CLength:
Sequence: GCTGTGGGAAGCGGTACG
(0 other experimental conditions)
Note:
Reverse(BHV1-4R-EXT) primer
Oligo type: PCRDegeneracy: 1
Target: 816-796Tm: 76.4 C at salt 1000.0mMLength:
Sequence: GTCGACTATGGCCTTGTGTGC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.