A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0015Publication date: 09/00
PMID: 11014610GI: 261087 Taxonomy ID: 10385
Virus Name: Bovine Herpesvirus 4, BHV-4Product size (PCR):
bp
MgCl2: 3 mMdNTPs: mMType: PCR
Temp (PCR cycle):(94C 1min>55C 1min>72C 2min)*30
Buffer: 10mM Tris HCl pH 8.3, 50mM KCl
Polymerase: 0.02U/microL Expand High-fidelity DNA poly (Biolyne, London, UK)Cycler:
Note:
Forward(MP00141) primer
Oligo type: Degeneracy: 1
Target: 1-25Tm: 73.9 C at salt 1000.0mMLength:
Sequence: CGAATTCTAGTCTAAAGTCATCCTC
(1 other experimental conditions)
Note:
Reverse(MP00142) primer
Oligo type: Degeneracy: 1
Target: 1225-1202Tm: 73.6 C at salt 1000.0mMLength:
Sequence: CGAATTCTCACACTTTCCAGGAAT
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.