A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0014Publication date: 09/00
PMID: 11014610GI: 261087 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4, BHV-4Product size (PCR):
bp
MgCl2: 3 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 5min>(94C 1min>55C 1min>72C 2min)*30>72C 5min
Buffer: 10mM Tris HCl pH 8.3, 50mM KCl
Polymerase: 0.02 U/microL Taq Poly (Boehringer-Diagnostics, Milan, Italy)Cycler:
Note:
Forward(Alpha) primer
Oligo type: PCRDegeneracy: 1
Target: 1-24Tm: 72.3 C at salt 1000.0mMLength:
Sequence: CGAATTATAGTCTAAAGTCATCCTC
(1 other experimental conditions)
Note: This is identical to the one in the GI except that in the GI it is missing the first C
Reverse(Beta) primer
Oligo type: PCRDegeneracy: 1
Target:
-
Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CGAATTCCATTGGCTTCATCCCACA
(0 other experimental conditions)
Note: This sequence coould not be found in the GI given but amplification of it and alpha led to a 2.571kb fragment.
Forward(MP00141) primer
Oligo type: PCRDegeneracy: 1
Target: 1-25Tm: 73.9 C at salt 1000.0mMLength:
Sequence: CGAATTCTAGTCTAAAGTCATCCTC
(1 other experimental conditions)
Note:
Reverse(MP00142) primer
Oligo type: PCRDegeneracy: 1
Target: 1225-1202Tm: 73.6 C at salt 1000.0mMLength:
Sequence: CGAATTCTCACACTTTCCAGGAAT
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.