A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0007Publication date: 12/96
PMID: 9233501GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(95C 1min>60C 1min>72C 2min)*35
Buffer: 10mM Tris-HCL pH 8.8, 50mM KCL, 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA polyCycler:
Note: Protocol designed by: (PMID: 2841484) Whitbeck, J.C., Bello, L.J., Lawrence, W.C., 1988. Comparison of the bovine herpesvirus 1 gI gene and herpes simplex virus type 1 gB gene. J. Virol. 62, 3319-3327.
Forward(MP00071) primer
Oligo type: PCRDegeneracy: 1
Target: 3234-3259Tm: 74.2 C at salt 1000.0mMLength:
Sequence: ATTTAAGTGCACACCTCTTATTTGCG
(0 other experimental conditions)
Note: This sequence is not identicle to the one in the GI, the similarities are, the first 15 nucleotides are the same in order after that 3 are the same and 8 are different however if you also segments that are identicle but are 1 nucleotide ahead of the primer, ex. attt and ttt
Reverse(MP00072) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 74.2 C at salt 1000.0mMLength:
Sequence: TTGCATTACTTTTGGGGTCAAATGTG
(1 other experimental conditions)
Note: No sequence match
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.