A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0001Publication date: 03/00
PMID: 10733743GI: 312185 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(94C 30sec>52C 60sec>72C 60sec)*35>72C 10min
Buffer: 50mM KCl, 10mM Tris-Cl (pH 8.3), 1% DMSO, 5% glycerol, 0.1% NP40
Polymerase: 0.025U/microL Taq polyCycler: MJ Research Minicycle
Note: Total PCR volume is 100microL.
Before the addition of the Taq polymerase, samples are heated to 95C for 10min.
The enzyme is added at 80C.
Article does not mention primer concentration used for PCR.

Each primer set is used in a separate PCR.
Primer set LVC 10/LVC 11 amplifies a 456bp product.
Primer set LVC 12/LVC 13 amplifies a 267bp product.
Primer set LVC 14/LVC 15 amplifies a 303bp product.
Primer set LVC 16/LVC 17 amplifies a 411bp product.
Primer set LVC 18/LVC 19 amplifies a 352bp product.
Reverse(LVC 11) primer
Oligo type: PCRDegeneracy: 1
Target: 885-868Tm: 60 CLength:
Sequence: CATGTACCGCCAGGGCAC
(0 other experimental conditions)
Note: Specific to ORF1
Forward(MP000101) primer
Oligo type: PCRDegeneracy: 1
Target: 84-103Tm: 78.2 C at salt 1000.0mMLength:
Sequence: GGATCCATGCAAGGGCCGAC
(0 other experimental conditions)
Note: This primer contains a BamHI restriction site
Reverse(MP000102) primer
Oligo type: PCRDegeneracy: 1
Target: 1335-1278Tm: 98.3 C at salt 1000.0mMLength:
Sequence: CTCGAGTCAACCGAACTGCGGGTGACGCCAAGCGCTCCCGGGCAGCGCGCTGTAGTT
(0 other experimental conditions)
Note: This primer contains the Streptag seqence and Xho I restriction site.
Streptag sequence: Sun, G., Budde, R.J.A., 1995. A modified pGEX expression system that eliminates degradation products and thrombin from the recombinant protein. Anal. Biochem. 231, 458-460.
Forward(LVC 10) primer
Oligo type: PCRDegeneracy: 1
Target: 417-430Tm: 44 CLength:
Sequence: GAAATGAGCCGAGG
(0 other experimental conditions)
Note: Secific to ORF1
Forward(LVC 12) primer
Oligo type: PCRDegeneracy: 1
Target: 1159-1177Tm: 75.8 C at salt 1000.0mMLength:
Sequence: ACGTACAGTCCAGCTGCGC
(0 other experimental conditions)
Note: Specific to ORF2
Reverse(LVC 13) primer
Oligo type: PCRDegeneracy: 1
Target: 1444-1426Tm: 78 C at salt 1000.0mMLength:
Sequence: ACGTCGGGCGGCGGCAAAA
(0 other experimental conditions)
Note: specific to ORF 2
Forward(LCV 14) primer
Oligo type: PCRDegeneracy: 1
Target: 2397-2405Tm: 28 CLength:
Sequence: CGTGCTCTT
(0 other experimental conditions)
Note: specific to ORF3
Reverse(LCV 15) primer
Oligo type: PCRDegeneracy: 1
Target: 2700-2682Tm: 75.8 C at salt 1000.0mMLength:
Sequence: GGACCTCTGCTTGAGCGGT
(0 other experimental conditions)
Note: specific to ORF3
Forward(LCV 16) primer
Oligo type: PCRDegeneracy: 1
Target: 3272-3289Tm: 66 CLength:
Sequence: CATGCCCGCCGCCCGGAC
(0 other experimental conditions)
Note: specific to ORF4
Reverse(LVC 17) primer
Oligo type: PCRDegeneracy: 1
Target: 3682-3655Tm: 87.9 C at salt 1000.0mMLength:
Sequence: AGACGCGGCCCGAGAGACTCTGGGCGTA
(0 other experimental conditions)
Note: specific to ORF4
Forward(LVC 18) primer
Oligo type: PCRDegeneracy: 1
Target: 7578-7596Tm: 75.8 C at salt 1000.0mMLength:
Sequence: TGTGGAACCACGAGCTGCG
(0 other experimental conditions)
Note: specific to ORF7
Reverse(LVC 19) primer
Oligo type: PCRDegeneracy: 1
Target: 7930-7912Tm: 75.8 C at salt 1000.0mMLength:
Sequence: TCACGAAGTGGCTGCACCG
(0 other experimental conditions)
Note: specific to ORF7
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.