A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MO0004Publication date: 01/99
PMID: 10028170GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1 BVDVProduct size (PCR): 287 bp
MgCl2: 3 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 5min>(94C 1min>57C 1min>72C 1min)*35
Buffer: 20mM tris-HCl (pH 8.4); 50mM KCl
Polymerase: 0.05 U/microL Taq poly (GIBCO BRL)Cycler:
Note: The reverse transcription was carried out in a volume of 20 microL containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM DTT, 0.5 mM dNTP, 150 pmol of the reverse primer B2, 200 u M-MLV reverse transcriptase (GIBCO BRL) and 2 microL RNA. The cDNA was synthesized at 37C for 15 min and the enzyme was inactivated for 5 min at 95C. Two PCR was preformed with B1/B2 primer pair and BE/B2 primer pair.
Forward(B1) primer
Oligo type: PCRDegeneracy: 1
Target: 185-195Tm: 76.4 C at salt 1000.0mMLength:
Sequence: AGGGTAGTCGTCAGTGGTTCG
(1 other experimental conditions)
Note: This primer is specific for pestivirus. Target area was specified in the article and is only for 11 base pairs.
Forward(BE) primer
Oligo type: PCRDegeneracy: 1
Target: 108-127Tm: 74.4 C at salt 1000.0mMLength:
Sequence: CATGCCCTTAGTAGGACTAGC
(1 other experimental conditions)
Note: This primer is specific for pestivirus. Target area specified in the article and is only for 19 base pairs
Reverse(B2) primer
Oligo type: PCRDegeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: This primer is specific for pestivirus. The target area was specified in the article and is only for 20 base pairs
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.