A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MO0001Publication date: 08/98
PMID: 9810617GI: 330756 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1 BHV1Product size (PCR): 468 bp
MgCl2: 2.5 mMdNTPs: mMType: NESTED PCR 1
Temp (PCR cycle):(95C 60sec>56C 60sec>72C 60sec)*35>72C 6min
Buffer: 10mM Tris-HCl pH 8.3; 50mM KCl; 5% glycerol
Polymerase: 1.0U/microL Taq polyCycler:
Note: The concentration of MgCl2 used was from 1.0 to 4.0 mM. The best results came from 2.5 mM.
The article did not mention if any concentrations did not work.
Forward(Ext F) primer
Oligo type: PCRDegeneracy: 1
Target: 1007-1028Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:
Reverse(Ext R) primer
Oligo type: PCRDegeneracy: 1
Target:
-
Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CTACCGTCACGTGAGTGGTACG
(1 other experimental conditions)
Note: No match on the BLAST search.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.