A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0026Publication date: 08/93
PMID: 8408445GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDVProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Nested PCR 2
RT-Nested PCR 1
Temp (PCR cycle):94C 30sec>(94C 30sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*30>72C 10min
Buffer: 10mM Tris-HCl (pH 9.0), 50mM KCl, 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth poly (ITC; Heidelberg)Cycler:
Note: For RT and primary PCR, [see KS0025].

Total PCR volume is 50microL cotaining 2microL primary PCR product and 1.0microM each primer.

PCR product is transferred and fixed to a nylon membrane (Hybond N+; Amersham). Hybridization is performed using probe and chemiluminescence procedure (ECL-system; Amersham) following instructions of the supplier.
Forward(B) primer
Oligo type: PCRDegeneracy: 1
Target: 4934-4956Tm: 69.7 C at salt 1000.0mMLength:
Sequence: GCAGATTTTGAAGAAAGACACTA
(2 other experimental conditions)
Note:
Reverse(C) primer
Oligo type: PCRDegeneracy: 1
Target: 5605-5588Tm: 54 CLength:
Sequence: TTGGTGTGTGTAAGCCCA
(3 other experimental conditions)
Note:
Forward(E) primer
Oligo type: HybridizationDegeneracy: 1
Target: 5559-5580Tm: 74.7 C at salt 1000.0mMLength:
Sequence: TAAAAGTGAGGAGGGGTCTGGA
(0 other experimental conditions)
Note: Used in Southern blot hybridization.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.