A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0025Publication date: 08/93
PMID: 8408445GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDVProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-Nested PCR 1
Temp (PCR cycle):94C 30sec>(94C 30sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*25>72C 10min
Buffer: N/A
Polymerase: N/ACycler:
Note: 17.5microL containing 3.0microL RNA, 5.0microM random primers (Life Technologies), 5.0mM MgCl2, 10mM Tris-HCl (pH 8.3), 50mM KCl, 0.01% gelatin, and 1.0mM each dNTP are incubated 70C 5min.
Total RT volume is 20microL containing 17.5microL RNA-primer mixture, 5U/microL MMLV RTase (Life Technologies), 0.25U/microL human placental RNase inhibitor (Life Technologies), and 2.5mM DTT.
RT temperature: 37C 15min>42C 30min>99C 5min.

PCR is performed as described by Mullis and Faloona (1987) [PMID:3431465] using 25nM each primer.

For secondary PCR, [see KS0026].
Forward(A) primer
Oligo type: PCRDegeneracy: 1
Target: 4661-4683Tm: 69.7 C at salt 1000.0mMLength:
Sequence: GAAAGCAAAGGCTTAAAGAAGTT
(1 other experimental conditions)
Note:
Reverse(D) primer
Oligo type: PCRDegeneracy: 1
Target: 5733-5712Tm: 74.7 C at salt 1000.0mMLength:
Sequence: TGACGCCATACTCTGTCTCATC
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.