A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0021Publication date: 12/97
PMID: 9607088GI: 9629818 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1Product size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35>72C 5min
Buffer: 10% glycerol, Taq polymerase buffer
Polymerase: 0.06U/microL Taq DNA polyCycler:
Note: Each primer set is used in a separate PCR:
P1/P2 (468bp-product) with annealing temperature as 56C.
P3/P4 (637bp-product) with annealing temperature as 60C.
P5/P6 (520bp-product) with annealing temperature as 62C.

Total PCR volume is 50microL containing DNA and 1.0microM each primer.
MgCl2 concentration used is between 1mM and 2.5mM.
Article does not mention amount of Taq buffer used.
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 56017-56038Tm: 78.5 C at salt 1000.0mMLength:
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note:
Reverse(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 56483-56463Tm: 76.4 C at salt 1000.0mMLength:
Sequence: CTACCGTCACGTGCTGTGTAC
(0 other experimental conditions)
Note:
Forward(P3) primer
Oligo type: PCRDegeneracy: 1
Target: 55863-55882Tm: 72 C at salt 1000.0mMLength:
Sequence: GCATCGGCGTCATTTACAAG
(0 other experimental conditions)
Note:
Reverse(P4) primer
Oligo type: PCRDegeneracy: 1
Target: 56498-56479Tm: 80.2 C at salt 1000.0mMLength:
Sequence: GCACCCAGTCCCAGGCTACC
(0 other experimental conditions)
Note:
Forward(P5) primer
Oligo type: PCRDegeneracy: 1
Target: 16780-16799Tm: 76.1 C at salt 1000.0mMLength:
Sequence: AGGACGGGGCTTCCGATTAG
(0 other experimental conditions)
Note:
Reverse(P6) primer
Oligo type: PCRDegeneracy: 1
Target: 17299-17280Tm: 76.1 C at salt 1000.0mMLength:
Sequence: ACTGGTTCCGCAACGGCTAC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.