A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0015Publication date: 01/99
PMID: 10028179GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDVProduct size (PCR): 288 bp
MgCl2: 2.2 mMdNTPs: mMType: RT-Nested PCR 2
RT-Nested PCR 1
Temp (PCR cycle):(94C 10sec>50C 30sec>72C 30sec)*25
Buffer: 1x PCR buffer
Polymerase: 0.025U/microL AmpliTaq polyCycler:
Note: For RT and primary PCR, [see KS0014].

PCR is performed using 5microL primary PCR product and 25pmol each primer.
Article does not mention total PCR volume.
Forward(324-U) primer
Oligo type: PCRDegeneracy: 2
Target: 108-128Tm: 73.9 C at salt 1000.0mMLength:
Sequence: ATGCCC(T/A)TAGTAGGACTAGCA
(3 other experimental conditions)
Note:
Reverse(Pest2-L) primer
Oligo type: PCRDegeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.