A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0014Publication date: 01/99
PMID: 10028179GI: 9626649 Taxonomy ID: 11099
Virus Name: pestivirus type 1, BVDVProduct size (PCR):
bp
MgCl2: 2.2 mMdNTPs: mMType: RT-Nested PCR 1
Temp (PCR cycle):94C 3min>(94C 45sec>54C 60sec>72C 60sec)*35 >72C 7min
Buffer: 1x PCR buffer
Polymerase: 0.025U/microL AmpliTaq polyCycler:
Note: RT-PCR is performed using reagents supplied in GeneAmp RNA PCR kit (Perkin Elmer).

10microL containing 6microL sample, 2x PCR buffer, 5.0microM primer Pest2-L are incubated 99C 5min.
Total RT volume is 20microL containing 10microL sample-primer mixture, 5mM MgCl2, 0.5mM dNTPs, 1U/microL RNA-se inhibitor, and 2.5U/microL MuLV RTase.
RT temperature: 42C 15min>99C 5min.

Total PCR volume is 100microL containing all 20microL cDNA and 0.25microM each primer.

For secondary PCR, [see KS0015].
Forward(P1U) primer
Oligo type: PCRDegeneracy: 1
Target: 98-118Tm: 76.4 C at salt 1000.0mMLength:
Sequence: GAGGCTAGCCATGCCCTTAGT
(3 other experimental conditions)
Note:
Reverse(Pest2-L) primer
Oligo type: PCRDegeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.