A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0013Publication date: 12/99
PMID: 10598083GI: 9629818 Taxonomy ID: 79889
Virus Name: Bovine herpesvirus type 1.1, BHV-1; Bovine herpesvirus 5, BHV-5Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR 2
Nested PCR 1 Nested PCR 2 Nested PCR 1 RT-Nested PCR 1 RT-Nested PCR 2
Temp (PCR cycle):94C 9min>(95C 1min>67C 1min>72C 1min)*35
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 5.0% DMSO
Polymerase: 0.02U/microL AmpliTaq Gold DNA poly (Perkin-Elmer)Cycler:
Note: Universal PCR. Primers amplify the following bovine herpesviruses:
type 1.1 [Taxonomy:79889].
type 5 [Taxonomy:35244].

For primary PCR, [see KS0012].

Total PCR volume is 50microL containing 1microL primary PCR product and 0.3microM each primer.

For other PCRs in this article, [see KS0006], [see KS0007], [see KS0008], [see KS0009], [see KS0010], [see KS0011].
Reverse(GC1) primer
Oligo type: PCRDegeneracy: 8
Target: 18250-18228Tm: Max Tm 89.3 C Min Tm 83.9 C at salt 1000.0mMLength:
Sequence: GCCGAGAG(A/C)CCGCC(A/G)G(A/C)CCGAGA
(1 other experimental conditions)
Note:
Forward(CR26) primer
Oligo type: PCRDegeneracy: 1
Target: 17773-17796Tm: 85.5 C at salt 1000.0mMLength:
Sequence: GCCTCGCGCTCGCAGAGCATCCAC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.