A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KS0003Publication date: 03/99
PMID: 10233945GI: 9629818 Taxonomy ID: 79889
Virus Name: Bovine herpesvirus type 1.1, BHV-1Product size (PCR): 203 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 1min>49C 1min>72C 1min)*35
Buffer: PCR buffer, Q solution (Qiagen)
Polymerase: 0.1U/microL Taq poly (Qiagen)Cycler:
Note: Total RT volume is 20microL containing 10microL RNA, 10mM dithiothreitol, 50mM Tris-HCl, 3mM MgCl2, 200ng/microL random hexamers, 0.2mM dNTPs, and 10U/microL MMLV RTase.
RT temperature: 37C 1hr>95C 5 min.

Total PCR volume is 50microL containing 3microM each primer and 2microL cDNA.
Article does not mention amount of PCR buffer and Q solution used.
Forward(UL26-2) primer
Oligo type: PCRDegeneracy: 1
Target: 60152-60172Tm: 74.4 C at salt 1000.0mMLength:
Sequence: TAGTTGCTGACGAGGTACAGG
(0 other experimental conditions)
Note:
Forward(
) primer
Oligo type:
Degeneracy: 1
Target: 60355-60335Tm: 72.5 C at salt 1000.0mMLength:
Sequence: GATCAACATTGACCACGCAAG
(0 other experimental conditions)
Note:
Reverse(UL26-1) primer
Oligo type: PCRDegeneracy: 1
Target: 60355-60334Tm: 74.7 C at salt 1000.0mMLength:
Sequence: GATCAACATTGACCACGCAAGC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.