A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: KO0001Publication date: 07/00
PMID: 10889405GI: 221806 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV1Product size (PCR): 298 bp
MgCl2: 12 mMdNTPs: mMType: PCR
Temp (PCR cycle):98C 5min>(98C 30sec>63C 30sec>75C 40sec)*35>74C 5min
Buffer: 8% DMSO
Polymerase: 0.0125U/microL DNA poly PFU (Stratagene)Cycler:
Note: All DNA/virus samples (20 microL) were heated to 100C 5min and then placed in ice followed by addition of the PCR cocktail which had been pre-heated to 90C 2min.
Forward(SW000130) primer
Oligo type: Degeneracy: 1
Target: 9759-9777Tm: 71.5 C at salt 1000.0mMLength:
Sequence: TAGAGGAGGGAAGGAATGG
(0 other experimental conditions)
Note:
Reverse(SW000101) primer
Oligo type: Degeneracy: 1
Target:
-
Tm: 75.2 C at salt 1000.0mMLength:
Sequence: atgtatgcccaaaacttataatatgaccag
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.