A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0075Publication date: 1998
PMID: 9608664GI: 61076 Taxonomy ID: 12111
Virus Name: Foot-and-mouth disease virus A, FMDV type A; Foot-and-mouth disease virus O, FMDV type O; Foot-and-mouth disease virus Asia 1, FMDV type Asia 1Product size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: Universal PCR
Temp (PCR cycle):(92C 30sec>60C 30sec>75C 90sec)*30>75C 5min
Buffer: N/A
Polymerase: 0.025U/microL Taq polyCycler: PTC-100 (MJ Research, Inc.)
Note: Primer PD00471 and PD00472 were used to amplify the following organisms:
Foot-and-mouth disease virus A, [Taxonomy:12111]
Foot-and-mouth disease virus O, [Taxonomy:12118]
Foot-and-mouth disease virus Asia 1, [Taxonomy:110195]
Total RT volume was 33microL containing 3ng/microL primer pj00412 and Ready-To-Go You-Prime First-Strand Beads (Pharmcacia), then the RT mixture was incubated at 37C for 1 hour.
Total PCR volume was 100microL containing 2.5ng/microL of each primer (PD00471 and PD00472) and 33miroL cDNA.
Forward(PD00471) primer
Oligo type: Degeneracy: 1
Target: 3193-3216Tm: 78.7 C at salt 1000.0mMLength:
Sequence: ACCCAACTGCTTACCACAAGGCAC
(0 other experimental conditions)
Note:
Reverse(PD00472) primer
Oligo type: Degeneracy: 1
Target: 3592-3572Tm: 74.4 C at salt 1000.0mMLength:
Sequence: ACGTCGGAGAAAAAGAAGGGC
(0 other experimental conditions)
Note:
Forward(pj00412) primer
Oligo type: Degeneracy: 1
Target: 6329-6348Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GCAGTGACGCCATGAACATC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.