A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0071Publication date: 11/01
PMID: 11724141GI: 13095578 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4Product size (PCR): 153 bp
MgCl2: 3 mMdNTPs: mMType: Semi-nested PCR 1
Temp (PCR cycle):94C 1min>(94C 1min>58C 2min>72C 3min)*35
Buffer: 10mM Tris pH 8.3, 50mM KCl
Polymerase: 0.02U/microL Taq polyCycler: N/A
Note: Total PCR volume is 50microL containing 20microg/mL sample of DNA and 0.5microM of each primer.
For secondary PCR, [see JX0072].
Forward(P1) primer
Oligo type: Degeneracy: 1
Target: 13279-13302Tm: 68.5 C at salt 1000.0mMLength:
Sequence: CATGACACACTATTTTAAGTACTA
(1 other experimental conditions)
Note: There is a mismatch at position 13298
Reverse(P2) primer
Oligo type: Degeneracy: 1
Target: 13431-13409Tm: 69.7 C at salt 1000.0mMLength:
Sequence: ATCTTTCTTTCAGTCTCACTGTA
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.