A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0069Publication date: 12/97
PMID: 9607092GI: 61063 Taxonomy ID: 12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV CProduct size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 4min>(95C 1min>55C 1min>72C 1.5min)*40>72C 5min
Buffer: PCR buffer
Polymerase: 0.05U/microL Taq poly (Promega)Cycler:
Note: Universal PCR. The primer sets V4/V7, V14/V2, V6/V7, V14/V12, V6/V10, V13/V2, and V4/V2 are used in separate PCRs to amplify the following viruses:
FMDV O [Taxonomy:12118]
FMDV A [Taxonomy:12111]
FMDV C [Taxonomy:12116]

AMV RTase and oligo(dT)15-primer (Reverse Transcription System, Promega) are used for RT.
Article does not mention RT final volume and other conditions.

Total PCR volume is 50microL containing 4microL RT product and 0.5microM each primer in a set.
Article does not mention concentration of PCR buffer used.
Forward(V6) primer
Oligo type: Degeneracy: 1
Target: 5607-5626Tm: 76.1 C at salt 1000.0mMLength:
Sequence: CAGAGATGTGGAAGAGCGCG
(2 other experimental conditions)
Note:
Reverse(V7) primer
Oligo type: Degeneracy: 1
Target: 5814-5796Tm: 75.8 C at salt 1000.0mMLength:
Sequence: GCGGAACAGCGCTTTGTCC
(2 other experimental conditions)
Note:
Reverse(V10) primer
Oligo type: Degeneracy: 1
Target: 6136-6115Tm: 76.6 C at salt 1000.0mMLength:
Sequence: CATCGACAATGCGAGTCTTGCC
(0 other experimental conditions)
Note:
Forward(V14) primer
Oligo type: Degeneracy: 1
Target: 6355-6375Tm: 74.4 C at salt 1000.0mMLength:
Sequence: ATGTTTGAGGAGGTGTTCCGC
(0 other experimental conditions)
Note:
Forward(V13) primer
Oligo type: Degeneracy: 1
Target: 6289-6309Tm: 74.4 C at salt 1000.0mMLength:
Sequence: AGAAATGTGTGGGACGTGGAC
(0 other experimental conditions)
Note: Mismatch at positions 6294 and 6303.
Reverse(V2) primer
Oligo type: Degeneracy: 1
Target: 6960-6941Tm: 67.9 C at salt 1000.0mMLength:
Sequence: TGATCTGTAGCTTGGTATCT
(0 other experimental conditions)
Note: Mismatch at position 6945.
Reverse(V12) primer
Oligo type: Degeneracy: 1
Target: 7088-7069Tm: 72 C at salt 1000.0mMLength:
Sequence: GGAAGCGGGAAAAGCTCTTT
(0 other experimental conditions)
Note:
Forward(V4) primer
Oligo type: Degeneracy: 1
Target: 5568-5587Tm: 74.1 C at salt 1000.0mMLength:
Sequence: TGACCCTGAACCACAACACG
(0 other experimental conditions)
Note: Mismatches at positions 5568, 5580, and 5583.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.