A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0067Publication date: 01/00
PMID: 10644091GI: 61076 Taxonomy ID: 12118
Virus Name: Foot-and-mouth disease virus OProduct size (PCR):
bp
MgCl2: 4.6 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 40sec>55C 30sec>72C 30sec)*31>72C 3min
Buffer: 18mM Tris-HCl (pH 8.3), 23mM KCl
Polymerase: 0.5microL Stoffel fragment of Taq poly (Perkin-Elmer)Cycler: Perkin-Elmer 9600
Note: Total RT volume is 10microL containing RNA, 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM dithiothreitol, 1 mM each dNTP, 0.5microM random hexamers (Gibco), 0.01U/microL RNAsin (Promega), and 2U/microL superscript II RTase.
RT temperature: 41C 45min>95C 8min>10C 3min.

Total PCR volume is 50microL containing all 10microL cDNA and 0.3microM each primers PD00387 and PD00388.
Article only gives Taq in volume used.

For other PCR in this article, [see JX0066].
Forward(PD00387) primer
Oligo type: Degeneracy: 1
Target: 4406-4429Tm: 77 C at salt 1000.0mMLength:
Sequence: ACAGGCAATTTCCACCCACTTCAC
(0 other experimental conditions)
Note:
Reverse(PD00388) primer
Oligo type: Degeneracy: 1
Target: 4751-4728Tm: 77 C at salt 1000.0mMLength:
Sequence: GTACCCATCCTTAGCACTCACATC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.