A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0050Publication date: 09/94
PMID: 7822459GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1)Product size (PCR): 198 bp
MgCl2: 1.3 mMdNTPs: mMType: nested RT-PCR2
nested RT-PCR1
Temp (PCR cycle):(95C 1min>45C 2min>72C 2min)*30>72C 9min
Buffer: 15mM Tris-HCl (pH 8.3), 58mM KCl
Polymerase: 0.05U/microL Taq poly (Perkin Elmer Cetus)Cycler: intelligent heating block (Hybaid)
Note: Total PCR volume is 50microL containing FMD virus-specific primers NK4 and P3, the concentration of primers was not given.
Oligonucleotide NK40 was used to verify the PCR product by non-radioactive dot-blot hybridization. The hybrids were detected by chemiluminescent reaction using hapten PPD (Boehringer).
For the first nested RT-PCR [see JX0049]
Forward(P3) primer
Oligo type: Degeneracy: 1
Target: 3363-3382Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CCTACCTCCTTCAACTACGG
(2 other experimental conditions)
Note:
Reverse(NK4) primer
Oligo type: Degeneracy: 1
Target: 3556-3540Tm: 54 CLength:
Sequence: ACGTCTCCCGCCAACTT
(0 other experimental conditions)
Note:
Reverse(NK40) primer
Oligo type: Degeneracy: 1
Target: 3433-3417Tm: 54 CLength:
Sequence: GCCCTCTTCATCCGGTA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.