A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0049Publication date: 09/94
PMID: 7822459GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1)Product size (PCR): 216 bp
MgCl2: 1.3 mMdNTPs: mMType: nested RT-PCR1
Temp (PCR cycle):(95C 1min>45C 2min>72C 2min)*30>72C 9min
Buffer: 15mM Tris-HCl (pH 8.3), 58mM KCl, 1mM DTT, 0.008mg/ml BSA
Polymerase: 0.05U/microL Taq poly (Perkin Elmer Cetus)Cycler: intelligent heating block (Hybaid)
Note: Total RT volume is 28microL containing 3ng/microL of random hexamer primers, 50mM Tris-HCl (pH 8.3), 75mM KCl, 10mM DTT, 3mM MgCl2, 0.08mg/ml BSA, 0.4mM dNTPs and 8U/microL of mouse moloney leukaemia virus RTase. The mixture was held at room temperature for 5min and incubated at 37C for 45min.
Total PCR volume is 50microL containing FMD virus-specific primers P1 and P3, the concentration of primers was not given.
For the second nested RT-PCR [see JX0050].
Reverse(P1) primer
Oligo type: Degeneracy: 1
Target: 3578-3559Tm: 78.2 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACT
(0 other experimental conditions)
Note:
Forward(P3) primer
Oligo type: Degeneracy: 1
Target: 3363-3382Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CCTACCTCCTTCAACTACGG
(2 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.