A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0030Publication date: 03/01
PMID: 11164915GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1)Product size (PCR):
bp
MgCl2: 2.2 mMdNTPs: mMType: PCR
Temp (PCR cycle):50C 2min>95C 10min>(95C 15sec>60C 60sec)*50
Buffer: 1x SYBR master mix (PE Applied Biosystems, UK)
Polymerase: Taq Gold thermostable poly (PE Applied Biosystems)Cycler: PE Applied Biosystems 5700 thermal cycler (PE Applied Biosystems, UK)
Note: Total RT volume is 10microL containing 3.85microL RNA, 50mM KCl, 10mM Tris-HCl (pH 8.3), 5.5mM MgCl2, 0.5 mM each dNTP, 2.5microM random hexamers, 0.4U/microL RNase inhibitos, 0.25U/microL MultiScribe Moloney RTase.
RT temperature: 48C 45min>95C 5min.

Total SYBR PCR volume is 25microL containing 0.6microM each primer.
Article does not mention polymerase concentration for PCR.

For TaqMan PCR [see JX0031].
Forward(SAIR 41F) primer
Oligo type: Degeneracy: 1
Target: 338-358Tm: 74.4 C at salt 1000.0mMLength:
Sequence: TGTTTGACTCCACGCTCGATC
(0 other experimental conditions)
Note:
Reverse(SAIR 172R) primer
Oligo type: Degeneracy: 1
Target: 469-449Tm: 74.4 C at salt 1000.0mMLength:
Sequence: TCCGTTAGGACATGGCTTTCG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.