A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JX0029Publication date: 02/95
PMID: 7714205GI: 61060 Taxonomy ID: 12113
Virus Name: Foot-and-mouth disease virus (strain A5); foot-and-mouth disease virus C1; Foot-and-mouth disease virus (strain O1)Product size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 15sec>55C 15sec>72C 45sec)*30
Buffer: 25mM Tris-HCl (pH 8.4), 75mM KCl
Polymerase: 0.025U/microL SuperTaq poly (Stehelin, Basel, Switzerland)Cycler: Bio-med Thermocycler 60 (Gesellschaft fur Biotechnologie und Medizinterchnik, Theres, Germany)
Note: Universal PCR. Primer sets SV1/A2 and SV1/P1 amplify the following viruses:
Foot-and-mouth disease virus (strain A5) [Taxonomy:12113]
foot-and-mouth disease virus C1 [Taxonomy:12121]
Foot-and-mouth disease virus (strain O1) [Taxonomy:73482]

40microL containing 5microL virus sample, 25mM Tris-HCl (pH 8.4), 75mM KCl, 2.5mM MgCl2, 0.25mM each dNTP, and 1.25microM primer (A2 or P1) are incubated at 90C for 5min.
Total RT volume is 45microL containing 0.2U/microL RNase inhibitor (Boehringer Mannheim), 1U/microL MMLV RTase (BRL Life Technologies), and 40microL RNA-primer solution.
RT temperature: 37C 30min.

Total PCR volume was 50microL containing all 45microL cDNA and 1microM primer SV1.

The article also used an Air Thermo-cycler 1605 (Idaho Thchnology, Idaho Falls, Idaho) with a temp cycle of (95C 5sec>55C 5sec>72C 20sec)*30. This tempcycler gave lower sensitivity but higher specificity.
Forward(SV1) primer
Oligo type: Degeneracy: 1
Target: 421-439Tm: 80.1 C at salt 1000.0mMLength:
Sequence: GCGCCACACCGCGTGTTGG
(0 other experimental conditions)
Note:
Reverse(A2) primer
Oligo type: Degeneracy: 1
Target: 569-550Tm: 67.9 C at salt 1000.0mMLength:
Sequence: GCTTTGATTGCACCATAGTT
(0 other experimental conditions)
Note:
Reverse(P1) primer
Oligo type: Degeneracy: 1
Target: 753-733Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.