A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JP0041Publication date: 01/02
PMID: 11808702GI: 902376 Taxonomy ID: 136447
Virus Name: bovine viral diarrhea virus type 2, BVDV 2Product size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Semi-Nested PCR 2
RT-Semi-Nested PCR 1
Temp (PCR cycle):94C 2min>(94C 1min>50C 1min>72C 1min)*30>72C 10min
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler(MJ research, Waltham MA, USA)
Note: First PCR mixture was diluted 1:500 with water, and 1microL was used in the reaction. Reaction contained 1microL each of 0.001mg/microL primers. Article does not mention final reaction volume.

For first PCR, [see JP0040]

For additional PCR in this article, [see JP0038], [see JP0039].
Forward(TS2) primer
Oligo type: Degeneracy: 1
Target: 1802-1821Tm: 70 C at salt 1000.0mMLength:
Sequence: TGGTTAGGGAAGCAATTAGG
(1 other experimental conditions)
Note: Mismatches at position 1810, 1816, 1817, 1819.
Reverse(P2) primer
Oligo type: Degeneracy: 1
Target: 2250-2222Tm: 77.8 C at salt 1000.0mMLength:
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at position 2234, 2237, 2246, 2247
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.