A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JP0040Publication date: 01/02
PMID: 11808702GI: 323205 Taxonomy ID: 121864
Virus Name: Bovine viral diarrhea virus-1, BVDV-1; Bovine viral diarrhea virus-2, BVDV-2Product size (PCR): n/a bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Semi-Nested PCR 1
Temp (PCR cycle):94C 2min>(94C 1min>55C 1min>72C 1min)*30>72C 10min.
Buffer: 1x PCR buffer
Polymerase: 0.05U/microL Taq polyCycler: PTC-100 thermal cycler (MJ research, Waltham MA, USA
Note: Universal PCR, viruses amplified are:
Bovine viral diarrhea virus-1 [Taxonomy:121864]
Bovine viral diarrhea virus-2 [Taxonomy:136447]

Total RT volume was 10microL and contained 2.5U/microL MuLV reverse transcriptase, 1U/microL RNase inhibitor, 100ng/microL primer P2, and 0.32mM dNTP. RT temperature: 42C 15min>99C 5min>4C 5min.

PCR contained 10microL cDNA and 20ng/microL of each primer. Article does not mention total reaction volume.

For nested PCR, [see JP0041]

For additional PCR in this article; [see JP0038], [see JP0039].
Forward(P1) primer
Oligo type: Degeneracy: 1
Target: 1424-1448Tm: 75.5 C at salt 1000.0mMLength:
Sequence: AACAAACATGGTTGGTGCAACTGGT
(1 other experimental conditions)
Note:
Reverse(P2) primer
Oligo type: Degeneracy: 1
Target: 2250-2222Tm: 77.8 C at salt 1000.0mMLength:
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at position 2234, 2237, 2246, 2247
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.