A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JP0039Publication date: 01/02
PMID: 11808702GI: 330752 Taxonomy ID: 10295
Virus Name: Bovine herpesvirus 2Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 3min>(94C 1min>68C 1min>72C 1min)*40>72C 10min
Buffer: 1x PCR Buffer, 2% DMSO
Polymerase: 0.05U/microL Taq DNA polyCycler: PTC-100 thermal cycler (MJ Research, Waltham MA, USA)
Note: Total RT volume was 10 microL and contained 2.5U/microL MuLV RTase, 1U/microL RNase inhibitor, 100ng/microL primer P2, and 0.32mM dNTP. RT temperature: 42C 15min>99C 5min>4C 5min.

Total PCR volume was 50microL,and contained 20ng/microL of each primer.

For other PCR in this article; [see JP0038], [see JP0040], [see JP0041].
Forward(4109) primer
Oligo type: Degeneracy: 1
Target: 2416-2440Tm: 87 C at salt 1000.0mMLength:
Sequence: GCGGCGGCGGAGTCTGGCTTTGAGG
(0 other experimental conditions)
Note:
Reverse(4110) primer
Oligo type: Degeneracy: 1
Target: 2837-2810Tm: 82 C at salt 1000.0mMLength:
Sequence: TCGCTGATGTTGTTCGGAGGGAGGTTGA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.