A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JP0038Publication date: 01/02
PMID: 11808702GI: 2653291 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV1Product size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 3min>(94C 1min>68C 1min>72C 1min)*40>72C 10min
Buffer: 1x PCR buffer, 2% DMSO
Polymerase: 0.5U/microL Taq DNA polyCycler: PTC-100 thermal cycler (MJ Research, Waltham MA, USA)
Note: Total RT volume was 10microL and contained 2.5U/microL MuLV RTase, 1U/microL RNase inhibitor, 100ng/microL primer P2, and 0.32mM dNTP. RT temperature: 42C 15min>99C 5min>4C 5min.

Total PCR volume was 50microL, and contained 20ng/microL of each primer.

For additional RT in this article, [see JP0039], [see JP0040], [see JP0041], [see JP0042].
Forward(766) primer
Oligo type: Degeneracy: 1
Target: 63775-63796Tm: 80.3 C at salt 1000.0mMLength:
Sequence: CAACCTCGTCGTGTGCACCCTC
(0 other experimental conditions)
Note:
Reverse(665) primer
Oligo type: Degeneracy: 1
Target: 64079-64059Tm: 80.3 C at salt 1000.0mMLength:
Sequence: AGAGCTCGCGGCACTTGAGCG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.