A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: JP0024Publication date: 02/01
PMID: 11222004GI: 12018088 Taxonomy ID: 12116
Virus Name: Foot-and-mouth disease virus CProduct size (PCR): N/A bp
MgCl2: N/A mMdNTPs: mMType: Hybridization
Temp (PCR cycle):42C Overnight
Buffer: In Situ Hyb Buffer(Ambion, Abingdon, UK)
Polymerase:
Cycler:
Note: Samples were hybridized in 100microL buffer containing 100ng/mL of each probe.
Reverse(FMDV-2AR) primer
Oligo type: Degeneracy: 1
Target: 3934-3909Tm: 80.5 C at salt 1000.0mMLength:
Sequence: TCGGAGAAAAAGAAGGGCCCAGGGTT
(0 other experimental conditions)
Note: Mismatches at 3914 and 3926
Reverse(FMDV-3BR) primer
Oligo type: Degeneracy: 1
Target: 6027-5999Tm: 80.6 C at salt 1000.0mMLength:
Sequence: GCTTTGTGTTGCCCATGACCATCTTTTGC
(0 other experimental conditions)
Note:
Reverse(FMDV-3CR) primer
Oligo type: Degeneracy: 1
Target: 6229-6200Tm: 82 C at salt 1000.0mMLength:
Sequence: GCGTCTGAGAGCATGTCCTGTCCTTTTACT
(0 other experimental conditions)
Note:
Reverse(FMDV-3DR) primer
Oligo type: Degeneracy: 1
Target: 6691-6666Tm: 82.1 C at salt 1000.0mMLength:
Sequence: GCGACGGTGGGTGCAAGCTTGGTTTT
(0 other experimental conditions)
Note: Mismatches at postions 6689, 6677, and 6680.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.