A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: HI0006Publication date: 10/95
PMID: 8578861GI: 323205 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL); pestivirus type 2 strain BVDV890; Border disease virus strain BD31Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Nested PCR 2
RT-Nested PCR 1
Temp (PCR cycle):(94C 60sec>50C 45sec>72C 45sec)*25
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.025U/microL Amplitaq (Perkin-Elmer Cetus)Cycler:
Note: For RT and primary PCR, [see HI0005].

Primer set TS1/P2 amplifies a 566bp product of BVDV890 [Taxonomy:54314].
Primer set TS2/P2 amplifies a 448bp product of BD31 [Taxonomy:157731].
Primer set TS3/P2 amplifies a 233bp product of NADL [Taxonomy:11100].

Secondary PCR is performed using 1microL diluted (1:500 in sterile distilled water) primary PCR product and 0.5microM each type-specific primers TS1, TS2, and TS3 in a multiplex PCR format.
Forward(TS1) primer
Oligo type: PCRDegeneracy: 1
Target: 1684-1715Tm: 75.6 C at salt 1000.0mMLength:
Sequence: TATATTATTTGGAGACAGTGAATGTAGTAGCT
(0 other experimental conditions)
Note: Multiple mismatches.
Forward(TS2) primer
Oligo type: PCRDegeneracy: 1
Target: 1802-1821Tm: 70 C at salt 1000.0mMLength:
Sequence: TGGTTAGGGAAGCAATTAGG
(1 other experimental conditions)
Note: Mulitple mismatches.
Forward(TS3) primer
Oligo type: PCRDegeneracy: 1
Target: 2027-2045Tm: 78 C at salt 1000.0mMLength:
Sequence: GGGGGTCACTTGTCGGAGG
(0 other experimental conditions)
Note:
Reverse(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 2250-2222Tm: 77.8 C at salt 1000.0mMLength:
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.