A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: HI0005Publication date: 10/95
PMID: 8578861GI: 323205 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL); pestivirus type 2 strain BVDV890; border disease virus strain BD31Product size (PCR): 826 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Nested PCR 1
Temp (PCR cycle):50C 30min>94C 2min>(94C 1min>55C 1min>72C 1min)*30>72C 10min
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3), 0.25mM dithiothreitol
Polymerase: 0.025U/microL Amplitaq (Perkin-Elmer Cetus)Cycler:
Note: Universal PCR. Primers are used to amplify:
NADL [Taxonomy:11100]
BVDV890 [Taxonomy:54314]
BD31 [Taxonomy:157731].

Single-step RT-PCR is performed in a total volume of 100microL containing 0.4U/microL RNasin (Promega), 0.025U/microL Rous-associated virus type-2 RTase (Amersham Corp, Arlington Heights, IL), and 0.5microM each primer.

For secondary PCR, [see HI0006].
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 1424-1448Tm: 75.5 C at salt 1000.0mMLength:
Sequence: AACAAACATGGTTGGTGCAACTGGT
(1 other experimental conditions)
Note: Mismatch at position 1429.
Reverse(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 2250-2222Tm: 77.8 C at salt 1000.0mMLength:
Sequence: CTTACACAGACATATTTGCCTAGGTTCCA
(3 other experimental conditions)
Note: Mismatches at positions 2227, 2242, and 2246.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.