A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: HI0003Publication date: 05/98
PMID: 9557713GI: 59839 Taxonomy ID: 69955
Virus Name: bovine lymphotropic herpesvirus, BLHV; Ovine herpesvirus 2, OHV2; Bovine herpesvirus 4, BHV4Product size (PCR):
bp
MgCl2: 2.0 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):94C 3min>60C 2min>72C 1min>(94C 30sec>60C 60sec>72C 60sec)*35
Buffer: 20mM Tris HCl (pH8.4), 50mM KCl, 2.5% dimethyl sulfoxide
Polymerase: 0.05U/microL Taq poly (Gibco)Cycler: Omnigene thermal cycler (Hybaid Limited, Middlesex, UK)
Note: Total primary PCR volume is 50microL containing 20ng/microL cellular DNA or 5microL viral template DNA and 1microM each primers DFA and KG1.

Total secondary PCR volume is 50microL containing 1microL primary PCR product and 1microM each primers DFA and a specific primer (3'BLHV, 3'OHV2, or 3'BHV4).
For secondary PCR, specific primers are:
Primer 3'BLHV is specific to BLHV [Taxonomy:69955], [GI:2832250].
Primer 3'BHV4 is specific to BHV4 [Taxonomy:10385], [GI:2832252].
Primer 3'OHV2 is specific to OHV2 [Taxonomy:10398], [GI:5231231].
Reverse(3'OHV2) primer
Oligo type: PCRDegeneracy: 1
Target: 483-461Tm: 80.4 C at salt 1000.0mMLength:
Sequence: CACTGTGAATCTCGGGGTCGGGT
(0 other experimental conditions)
Note: Specific to OHV2 [GI:5231231].
Forward(ILK) primer
Oligo type: PCRDegeneracy: 1024
Target: 2405-2434Tm: Max Tm 86.4 C Min Tm 77.6 C at salt 1000.0mMLength:
Sequence: TCCTGGACAAGCAGCA(A/G)(A/G/C/T)(C/T)(G/C)GC(A/G/C/T)(A/C)T(A/G/C/T)AA
(0 other experimental conditions)
Note: Herpesvirus DNA Polymerase(HHV1)
Reverse(KG1) primer
Oligo type:
Degeneracy: 128
Target: 2857-2883Tm: Max Tm 83.7 C Min Tm 77.3 C at salt 1000.0mMLength:
Sequence: GTCTTGCTCACCAG(A/G/C/T)TC(A/G/C/T)AC(A/G/C/T)CC(C/T)TT
(0 other experimental conditions)
Note: Herpesvirus DNA Polymerase(HHV1)
Forward(TVG) primer
Oligo type: PCRDegeneracy: 1372
Target: 2440-2469Tm: Max Tm 84.7 C Min Tm 88.8 C at salt 1000.0mMLength:
Sequence: TGTAACTCGGTGTA(C/T)GG(A,G,C,T, or U)TT(C/T)AC(A,G,C,T, or U)GG(A,G,C,T, or U)GT
(0 other experimental conditions)
Note: Herpesvirus DNA Polymerase(HHV1)
The upstream primer used in the second amplification.
Reverse(KG1) primer
Oligo type: PCRDegeneracy: 128
Target: 2882-2857Tm: Max Tm 83.7 C Min Tm 77.3 C at salt 1000.0mMLength:
Sequence: GTCTTGCTCACCAG(A/C/G/T)TC(A/C/G/T)AC(A/C/G/T)CC(C/T)TT
(2 other experimental conditions)
Note: Specific to [GI:59839].
Reverse(3'BLHV) primer
Oligo type: Degeneracy: 1
Target: 480-460Tm: 80.3 C at salt 1000.0mMLength:
Sequence: CACGCGCAAGCTAGGATCGGC
(1 other experimental conditions)
Note: Specific to BLHV [GI:2832250].
Reverse(3'BHV4) primer
Oligo type: Degeneracy: 1
Target: 468-446Tm: 73.2 C at salt 1000.0mMLength:
Sequence: TACTCTAAATGAGGCATCTGGGT
(2 other experimental conditions)
Note: Specific to BHV4 [GI:2832252].
Reverse(DFA) primer
Oligo type: Degeneracy: 512
Target: 2149-2168Tm: Max Tm 78.2 C Min Tm 63.8 C at salt 1000.0mMLength:
Sequence: GA(C/T)TT(C/T)GC(A/C/G/T)AG(C/T)(C/T)T(A/C/G/T)TA(C/T)CC
(2 other experimental conditions)
Note: Specific to [GI:59839].
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.