A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0034Publication date: 07/92
PMID: 1318605GI: 7960753 Taxonomy ID: 144353
Virus Name: Bovine viral diarrhea virus, BVDVProduct size (PCR): 890 bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>50C 1min>72C 1min)*30
Buffer: 1x Taq buffer (Promega)
Polymerase: 0.02 U/microL Taq Poly (Promega)Cycler: automatic tempcycler (Coy Inc.)
Note: First-strand cDNA synthesis was performed using 5 microg of RNA and according to the procedure provided with the Riboclone cDNA synthesis system (Promega).
The 2microL product was added to PCR cocktail containg 0.25microM each PCR primer (10 and 14). Primer 11 was used for cDNA production.
Forward(10) primer
Oligo type: PCRDegeneracy: 1
Target: 4546-4564Tm: 44 CLength:
Sequence: GGACTTTATGTACTAC
(0 other experimental conditions)
Note: This primer was listed in article as ending with 4564, when it actually ended with 4561.
PCR primer.
Forward(14) primer
Oligo type: PCRDegeneracy: 1
Target: 7545-7564Tm: 65.8 C at salt 1000.0mMLength:
Sequence: TCCCAATGATAACAGACATA
(0 other experimental conditions)
Note: PCR primer.
Reverse(11) primer
Oligo type: OtherDegeneracy: 1
Target: 5703-5686Tm: 52 CLength:
Sequence: CTGTTGTTGCTTTGGCAA
(0 other experimental conditions)
Note: RT primer
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.