A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0027Publication date: 01/92
PMID: 1311133GI: 7960753 Taxonomy ID: 144353
Virus Name: bovine viral diarrhea virus, BVDV, Border Disease Virus, BDVProduct size (PCR): 482 bp
MgCl2: 3 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 1min>60C 2min>72C 4min)*50
Buffer: 50mM KCl, 0.20mg/microL gelatine
Polymerase: 0.02 U/microL Taq Poly (Perkin Elmer Cetus Corp.)Cycler: Thermocycler (Perkin Elmer Cetus Corp.)
Note: Total RT volume was 20microL.
RNA preparations were made from Madin-darby bovine kidney (MDBK) infected with bovine viral diarrhea virus (BVDV) strains NADL, Osloss, Oregon, or A1138/69, and from foetal bovine epithlium (FBE) cells infected with BDV strain BD-112, pestivirus strains of questionable identity 84/9 and 5250.
Reverse transcription conditions: 62.5microg/mL RNA was heated at 65C for 10min and then cooled on ice for 5min. This was added to RT Buffer (50mM Tris-HCl pH 8.4, 5mM MgCl2, 50mM KCl, 5mM dithiothreitol, 50microg/mL bovine serum albumine), 0.10microM each dNTP, 0.25microM primer 147R, 5U/microL Moloney Leukemia Virus (MLV) reverse transcriptase. The mixture was heated at 37C 45min>94C 7min, and then chilled on ice. 4.8g/mL RNase A (Pharmacia) was added to mixture proceeded by incubation at 37C for 30min.
Total PCR volume was 101.4microL.
PCR was performed on the 7 RT products.
0.50microM each 147R and 180L primers was added to PCR reaction.

Southern Hybridization: Southern blots were prepared on gene screen plus membranes (NEN Dupont). 5mg/microL probe DNA (probe 145) was 5' end labelled with 25microCi (gamma-32P) ATP (Amersham) and 0.2 U/microL T4 polynucleotide kinase at 37C for 120min in a final volume of 25 microL. The reaction was stopped with 33microM EDTA and the 32P-labelled probe was purified on a Sephandex G50 (Pharmacia) column.
The membranes were prehybridized at 50C overnight in a buffer containing 3XSSC (0.45 M NaCl and 0.045 M sodium citrate), 5x Denhardt's (0.1% ficoll 400, 0.1%polyvinylpyrrolidone, and 0.1% bovine serum albumin), 0.5% SDS, 0.05Sodium pyrophosphate (NaPPi),100 microg/ml fragmented salmon sperm DNA and 20microg.ml tRNA. at least 10^5cpm of probe per ml then added, and blots were hybridized at 50C overnight. Membranes were washed twice in 3x SSC, 0.05% Na PPi, 0.1% SDS for 5 min at room temp and once at 50C for 15 min. Autoradiography was at room temperature with Kodak XAR-5 films for 0.5-48 hours.

Bovine diarrhea virus (strain NADL) Taxonomy ID: 11100
Bovine viral diarrhea virus (strain Oregon) Taxonomy ID: 82470
Bovine viral diarrhea virus (strain Osloss) Taxonomy ID: N/A
Bovine viral diarrhea virus (A1138/69) Taxonomy ID: N/A
Border Disease Virus (BD-112) Taxonomy ID:11101
Reverse(147R) primer
Oligo type: PCRDegeneracy: 1
Target: 7418-7458Tm: 89.1 C at salt 1000.0mMLength:
Sequence: GCTTCAGTGCTTTACCAGTCTCCACTACCTGCTGGTTCCC
(0 other experimental conditions)
Note: Codes for the genomic region p80 of BVDV strain NADL. This primer was used for RT and PCR.
Forward(180L) primer
Oligo type: PCRDegeneracy: 1
Target: 6976-7016Tm: 87 C at salt 1000.0mMLength:
Sequence: CCAGGAAACAGCAACAGGGTCAAAGGACTACCACTATGAC
(0 other experimental conditions)
Note: Codes for the genomic region p80 of BVDV strain NADL. Primer used for PCR.
Forward(145) primer
Oligo type: Hydridization ProbeDegeneracy: 1
Target: 7190-7230Tm: 88 C at salt 1000.0mMLength:
Sequence: ATGCAAGTTGGATTGGCTCTGGGTGATCAGTCCTGGCCAT
(0 other experimental conditions)
Note: Probe for the genomic region p80 of BVDV strain NADL. Probe for PCR products. It was labelled with 32P at 5' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.