A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: CW0017Publication date: 1996
PMID: 8865582GI: 9629818 Taxonomy ID: 79889
Virus Name: Bovine herpesvirus 1.1, BHV 1.1Product size (PCR): 430 bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 30sec>(94C 15sec>67C 15sec>72C 60sec)*35>72C 5 min
Buffer: 50mM KCl,10mM Tris-HCl, 5% (w/v) Glycerol, and 0.01% (w/v) Gelatin
Polymerase: 0.025 U/microL Taq polymerase (Perkin Elmer)Cycler: Type 9600 Perkin Elmer thermocycler, Norwalk, CT
Note: A "hot start" was performed @ 80C for 10min then 40 microL of buffer and 10 microL sample of DNA was added. Then PCR was performed.
Forward(CW00170) primer
Oligo type: PCRDegeneracy: 1
Target: 119085-119105Tm: 82.2 C at salt 1000.0mMLength:
Sequence: GTCGAGGTGCGCTACGCGACG
(0 other experimental conditions)
Note:
Reverse(CW00171) primer
Oligo type: PCRDegeneracy: 1
Target: 119515-119496Tm: 85.7 C at salt 1000.0mMLength:
Sequence: CCGCGAGCCGCGCCGAGTTTGCA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.